Resources

Resource: HAPT LUC insertion aléatoire 275

Resource


Resource name : HAPT LUC insertion aléatoire 275

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta04g03530

View this target on JBrowse
Link:
Start sequence :
ccacgcagggcactttgtcgcgcctcagagacgactactcgcgcgcgctag
Chromosome : 4
Start position: 572625
End position: 572675
View on JBrowse
Transgene sequence :
taatttcatgggtcgtgactcgcacggagtattttcaactcaccgcgaact
Chromosome : 4
Start position: 3181
End position: 3231
View on JBrowse

Order