Resources

Resource: HAPT LUC insertion aléatoire 196

Resource


Resource name : HAPT LUC insertion aléatoire 196

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta04g01380

View this target on JBrowse
Link:
Start sequence :
acgaatcgcacgacccggtacacttggtggcgtcatcgctcgcggacgctc
Chromosome : 4
Start position: 547867
End position: 547917
View on JBrowse
Transgene sequence :
ctgcgcgcgcggtcggggccacggacgcgggcgccggtgagttcgcggtga
Chromosome : 4
Start position: 3142
End position: 3192
View on JBrowse

Order