Resources

Resource: HAPT LUC insertion aléatoire 179

Resource


Resource name : HAPT LUC insertion aléatoire 179

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta01g06270

View this target on JBrowse
Link:
Start sequence :
gcgatgcgcgtgacgttcgtcaccgggaacgcgaaaaagttggaggaagtgcgagcgatcttaggcgccgggtcgacgatcg
Chromosome : 1
Start position: 1005747
End position: 1005828
View on JBrowse
Transgene sequence :
gaccggcggcgtcaagaagccgcacaggtaccgcccgggtaccgttgcgct
Chromosome : 1
Start position: 3581
End position: 3631
View on JBrowse

Order