Resources

Resource: HAPT LUC insertion aléatoire 169

Resource


Resource name : HAPT LUC insertion aléatoire 169

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta19g00160

View this target on JBrowse
Link:
Start sequence :
tcggctcgaaccattatttttcagaaaattaacacgaaaattcatgattttcgtccgaacctcgacgacgcgatactgagcgagagacgacgagcgatggctcgttggaaagctcgtaagttttcctaaaatatattctcgaatgagcgcaatcggcgcacgcgtcgcgacgctagacgcgcgcaaacacgaaaattaacatttttcatactttttaccgaaatccctt
Chromosome : 19
Start position: 40778
End position: 41006
View on JBrowse
Transgene sequence :
cacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtc
Chromosome : 19
Start position: 3834
End position: 3884
View on JBrowse

Order