Resources

Resource: HAPT LUC insertion aléatoire 121

Resource


Resource name : HAPT LUC insertion aléatoire 121

Genomics


Type of strand: Reporter strain
Manufacturing protocol: HAPT LUC insertion aléatoire
Sequence : HAPT LUC
Target: gene : ostta08g02970

View this target on JBrowse
Link:
Start sequence :
ggcgccttggtgggatacggcgtcttaaagggcaacgacatgtcccccgc
Chromosome : 8
Start position: 484171
End position: 484220
View on JBrowse
Transgene sequence :
atgaataaattgcagtttcatttgatgctcgatgagtttttctaataatca
Chromosome : 8
Start position: 2290
End position: 2340
View on JBrowse

Order